Stem-loop sequence mml-mir-6827

AccessionMI0023665 (change log)
DescriptionMacaca mulatta miR-6827 stem-loop
Gene family MIPF0001747; mir-6827
Stem-loop
   -----g      c  u     u u     gu 
5'       ugggaa ca aaggg c gugcu  c
         |||||| || ||||| | |||||  u
3'       acccuu gu uucuc g cacga  c
   ccuagg      u  c     u c     gu 
Get sequence
Deep sequencing
659 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 167625693-167625752 [+]
sense
ENSMMUT00000004635 ; CPNE4-201; intron 7
Database links

Mature sequence mml-miR-6827-5p

Accession MIMAT0028312
Sequence

1 - 

gugggaaccauaagggucugugc

 - 23

Get sequence
Deep sequencing569 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-6827-3p

Accession MIMAT0028313
Sequence

35 - 

accgucucuucuguuucccaggaucc

 - 60

Get sequence
Deep sequencing87 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).