Stem-loop sequence mml-mir-7182

AccessionMI0023664 (change log)
DescriptionMacaca mulatta miR-7182 stem-loop
Stem-loop
   --   g                  c   gga 
5'   auc caguuuuagaauccaugc uuu   a
     ||| |||||||||||||||||| |||    
3'   uag gucaaaauuuuagguacg aaa   u
   cg   g                  a   aua 
Get sequence
Deep sequencing
604 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 120363424-120363485 [+]
intergenic
Database links

Mature sequence mml-miR-7182-5p

Accession MIMAT0028310
Sequence

1 - 

aucgcaguuuuagaauccaugc

 - 22

Get sequence
Deep sequencing13 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7182-3p

Accession MIMAT0028311
Sequence

41 - 

auggauuuuaaaacugggaugc

 - 62

Get sequence
Deep sequencing564 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).