Stem-loop sequence mml-mir-7181

AccessionMI0023663 (change log)
DescriptionMacaca mulatta miR-7181 stem-loop
Stem-loop
   --          -c   aga      ---   c 
5'   uggguccugg  ugg   ucucug   cug c
     ||||||||||  |||   ||||||   |||  
3'   acucaggacc  acc   ggagac   gac c
   gg          uc   -ga      uca   c 
Get sequence
Deep sequencing
1411 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 41035061-41035121 [+]
sense
ENSMMUT00000019346 ; NUP93-201; intron 4
Clustered miRNAs
< 10kb from mml-mir-7181
mml-mir-138chr20: 41029997-41030080 [+]
mml-mir-7181chr20: 41035061-41035121 [+]
Database links

Mature sequence mml-miR-7181-5p

Accession MIMAT0028308
Sequence

1 - 

uggguccuggcuggagaucucu

 - 22

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7181-3p

Accession MIMAT0028309
Sequence

40 - 

aggagccacuccaggacucagg

 - 61

Get sequence
Deep sequencing1400 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).