Stem-loop sequence mml-mir-4677

AccessionMI0023662 (change log)
DescriptionMacaca mulatta miR-4677 stem-loop
Gene family MIPF0001848; mir-4677
Stem-loop
   --uu             u   c  u  ccu 
5'     guucuuuggucuu cag ca ga   g
       ||||||||||||| ||| || ||    
3'     caagaaaccagag guc gu cu   a
   ucau             u   u  -  ucc 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 219769840-219769898 [+]
intergenic
Database links

Mature sequence mml-miR-4677-5p

Accession MIMAT0028306
Sequence

1 - 

uuguucuuuggucuuucagcca

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-4677-3p

Accession MIMAT0028307
Sequence

38 - 

ucugugagaccaaagaacuacu

 - 59

Get sequence
Deep sequencing73 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).