Stem-loop sequence mml-mir-7180

AccessionMI0023661 (change log)
DescriptionMacaca mulatta miR-7180 stem-loop
Gene family MIPF0002036; mir-7180
Stem-loop
   --a      u   u      u u   uau 
5'    guguac ucc gaggcc c ggg   a
      |||||| ||| |||||| | |||    
3'    caugug ggg cuccgg g ccu   a
   ucc      u   u      u u   uaa 
Get sequence
Deep sequencing
1056 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 221549374-221549431 [+]
intergenic
Database links

Mature sequence mml-miR-7180-5p

Accession MIMAT0028304
Sequence

1 - 

aguguacuuccugaggccucu

 - 21

Get sequence
Deep sequencing616 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7180-3p

Accession MIMAT0028305
Sequence

38 - 

uggccucuggguguguacccu

 - 58

Get sequence
Deep sequencing439 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).