Stem-loop sequence mml-mir-7179

AccessionMI0023660 (change log)
DescriptionMacaca mulatta miR-7179 stem-loop
Stem-loop
   --             c           ag 
5'   auacgugacaaag uccugaaaaua  u
     ||||||||||||| |||||||||||  c
3'   uaugcacuguuuc aggacuuuuau  a
   ag             a           ag 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 79004693-79004751 [-]
intergenic
Database links

Mature sequence mml-miR-7179-5p

Accession MIMAT0028302
Sequence

1 - 

auacgugacaaagcuccugaaa

 - 22

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7179-3p

Accession MIMAT0028303
Sequence

38 - 

ucaggaacuuugucacguauga

 - 59

Get sequence
Deep sequencing26 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).