Stem-loop sequence mml-mir-7178

AccessionMI0023659 (change log)
DescriptionMacaca mulatta miR-7178 stem-loop
Stem-loop
   --u      u       c        caa ug 
5'    aggagc aucagaa uuagugau   g  a
      |||||| ||||||| ||||||||   |   
3'    uucucg uagucuu aaucauug   c  a
   ccc      -       u        aug ug 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 195983287-195983349 [-]
sense
ENSMMUT00000010160 ; DNM3-203; intron 16
ENSMMUT00000010159 ; DNM3-201; intron 17
Database links

Mature sequence mml-miR-7178-5p

Accession MIMAT0028300
Sequence

1 - 

uaggagcuaucagaacuuagug

 - 22

Get sequence
Deep sequencing74 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mml-miR-7178-3p

Accession MIMAT0028301
Sequence

43 - 

cuaauuucugaugcucuuccc

 - 63

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).