Stem-loop sequence mml-mir-7177

AccessionMI0023658 (change log)
DescriptionMacaca mulatta miR-7177 stem-loop
Gene family MIPF0002020; mir-7177
Stem-loop
   --     a      a aac   ag   gaauu    cu 
5'   ucagg caccag g   cau  agc     acuu  u
     ||||| |||||| |   |||  |||     ||||   
3'   ggucc gugguc c   gua  ucg     ugag  c
   aa     c      c cua   aa   -----    ac 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 203073472-203073542 [-]
antisense
ENSMMUT00000044735 ; LMX1A-201; intron 3
ENSMMUT00000008821 ; LMX1A-202; intron 3
Database links

Mature sequence mml-miR-7177-5p

Accession MIMAT0028298
Sequence

1 - 

ucaggacaccagagaaccauag

 - 22

Get sequence
Deep sequencing29 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7177-3p

Accession MIMAT0028299
Sequence

50 - 

augauccccuggugcccuggaa

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).