Stem-loop sequence mml-mir-518a-2

AccessionMI0023656 (change log)
DescriptionMacaca mulatta miR-518a-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -   -           c      -guu  c 
5'  cua caaagggaagc cuuucu    gu u
    ||| ||||||||||| ||||||    ||  
3'  ggu guuucucuucg gaaaga    ca a
   g   c           u      aaau  a 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49108097-49108155 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518a-2
mml-mir-519bchr19: 49102330-49102410 [+]
mml-mir-521chr19: 49104021-49104107 [+]
mml-mir-518echr19: 49105593-49105679 [+]
mml-mir-518a-2chr19: 49108097-49108155 [+]
mml-mir-516a-1chr19: 49109628-49109716 [+]
mml-mir-516a-2chr19: 49114285-49114373 [+]
mml-mir-517bchr19: 49115787-49115898 [+]
Database links

Mature sequence mml-miR-518a-5p

Accession MIMAT0006377
Sequence

1 - 

cuacaaagggaagcccuuucu

 - 21

Get sequence
Deep sequencing76 reads, 3 experiments
Evidence not experimental

Mature sequence mml-miR-518a-3p

Accession MIMAT0006378
Sequence

39 - 

aaagugcuucucuuugcuggg

 - 59

Get sequence
Deep sequencing276 reads, 5 experiments
Evidence not experimental

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).