Stem-loop sequence mml-mir-518g

AccessionMI0023655 (change log)
DescriptionMacaca mulatta miR-518g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   --         a   c          ggc 
5'   cucuagagg aag gcuuucuguu   c
     ||||||||| ||| ||||||||||   a
3'   gagauuucc uuc cgaaggauaa   a
   gu         c   a          gaa 
Get sequence
Deep sequencing
255 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49075909-49075967 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518g
mml-mir-518a-1chr19: 49066416-49066502 [+]
mml-mir-520gchr19: 49068463-49068552 [+]
mml-mir-518d-1chr19: 49073236-49073345 [+]
mml-mir-518gchr19: 49075909-49075967 [+]
mml-mir-518d-2chr19: 49077769-49077827 [+]
mml-mir-523bchr19: 49080348-49080436 [+]
Database links

Mature sequence mml-miR-518g-5p

Accession MIMAT0028296
Sequence

1 - 

cucuagaggaaagcgcuuucugu

 - 23

Get sequence
Deep sequencing246 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-518g-3p

Accession MIMAT0028297
Sequence

37 - 

aggaagcacuucccuuuagagug

 - 59

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).