Stem-loop sequence mml-mir-6794

AccessionMI0023653 (change log)
DescriptionMacaca mulatta miR-6794 stem-loop
Gene family MIPF0001726; mir-6794
Stem-loop
   --ca                   --   acag 
5'     gggggacugggggugagca  ggc    a
       |||||||||||||||||||  |||     
3'     cucccuggcucucacucgu  ucg    c
   aucc                   gc   accc 
Get sequence
Deep sequencing
183 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 12800689-12800750 [+]
sense
ENSMMUT00000027096 ; NFIX-201; intron 1
ENSMMUT00000027097 ; NFIX-202; intron 1
ENSMMUT00000027099 ; NFIX-203; intron 1
ENSMMUT00000027100 ; NFIX-204; intron 1
Database links

Mature sequence mml-miR-6794-5p

Accession MIMAT0028294
Sequence

1 - 

cagggggacugggggugagc

 - 20

Get sequence
Deep sequencing177 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-6794-3p

Accession MIMAT0028295
Sequence

43 - 

ucacucucggucccucccua

 - 62

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).