Stem-loop sequence mml-mir-7176

AccessionMI0023652 (change log)
DescriptionMacaca mulatta miR-7176 stem-loop
Stem-loop
   --a  c              a     cc  cc 
5'    cc ggaguggaggggac ggggc  ag  a
      || |||||||||||||| |||||  ||  a
3'    gg ccucaccuuccuug cccug  uc  a
   acc  u              a     ac  cc 
Get sequence
Deep sequencing
46 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 31475312-31475376 [-]
intergenic
Database links

Mature sequence mml-miR-7176-5p

Accession MIMAT0028292
Sequence

1 - 

acccggaguggaggggacaggg

 - 22

Get sequence
Deep sequencing40 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7176-3p

Accession MIMAT0028293
Sequence

44 - 

caguuccuuccacuccuggcca

 - 65

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).