Stem-loop sequence mml-mir-7175

AccessionMI0023651 (change log)
DescriptionMacaca mulatta miR-7175 stem-loop
Stem-loop
   --  ga aug g     ggc  aa    ag 
5'   ag  c   u gguua   ag  guag  g
     ||  |   | |||||   ||  ||||   
3'   uc  g   a ucagu   uc  cguc  a
   gg  ag --g g     --a  aa    cu 
Get sequence
Deep sequencing
471 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 30791709-30791764 [-]
intergenic
Database links

Mature sequence mml-miR-7175-5p

Accession MIMAT0028290
Sequence

1 - 

aggacauguggguuaggcagaaguaga

 - 27

Get sequence
Deep sequencing294 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7175-3p

Accession MIMAT0028291
Sequence

34 - 

ugcaacuaugacugagggacugg

 - 56

Get sequence
Deep sequencing177 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).