Stem-loop sequence mml-mir-6790

AccessionMI0023650 (change log)
DescriptionMacaca mulatta miR-6790 stem-loop
Gene family MIPF0001811; mir-6790
Stem-loop
   --a       u   u   g       -   -g g 
5'    gugagug gga uug cgggguu ccg  g u
      ||||||| ||| ||| ||||||| |||  |  
3'    cacucac ccu aac gcuccag ggc  c c
   ugc       u   c   g       c   ag c 
Get sequence
Deep sequencing
420 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 6592048-6592113 [-]
intergenic
Database links

Mature sequence mml-miR-6790-5p

Accession MIMAT0028288
Sequence

1 - 

agugaguguggauuuggcgggg

 - 22

Get sequence
Deep sequencing169 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-6790-3p

Accession MIMAT0028289
Sequence

45 - 

ucggcaacuccucacucaccgu

 - 66

Get sequence
Deep sequencing247 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).