Stem-loop sequence mml-mir-7174

AccessionMI0023649 (change log)
DescriptionMacaca mulatta miR-7174 stem-loop
Stem-loop
   --ag  g         u       u    uuu 
5'     ga ugacagagu agacucu uuuu   u
       || ||||||||| ||||||| ||||    
3'     cu acugucucg ucugaga agag   u
   cgga  g         c       c    cuu 
Get sequence
Deep sequencing
782 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr18: 2204518-2204581 [+]
intergenic
Database links

Mature sequence mml-miR-7174-5p

Accession MIMAT0028286
Sequence

1 - 

aggagugacagaguuagacucu

 - 22

Get sequence
Deep sequencing696 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7174-3p

Accession MIMAT0028287
Sequence

43 - 

agucucgcucugucagucaggc

 - 64

Get sequence
Deep sequencing41 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).