Stem-loop sequence mml-mir-7172

AccessionMI0023647 (change log)
DescriptionMacaca mulatta miR-7172 stem-loop
Stem-loop
   --a   -    c       c    ugug 
5'    ggc cucu aggguuu ugga    u
      ||| |||| ||||||| ||||    g
3'    cug gaga ucccaaa accu    u
   cca   a    c       u    ugug 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr18: 24163604-24163659 [-]
antisense
ENSMMUT00000009595 ; FHOD3-201; intron 3
ENSMMUT00000048235 ; FHOD3-202; intron 3
Database links

Mature sequence mml-miR-7172-5p

Accession MIMAT0028282
Sequence

1 - 

aggccucucaggguuucugg

 - 20

Get sequence
Deep sequencing77 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7172-3p

Accession MIMAT0028283
Sequence

36 - 

auaaacccucagagagucacc

 - 56

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).