Dead miRNA entry

miRNA accession:
MI0023646
miRNA ID:
mml-mir-133d
Forward to:
MI0002533
Comment:
mir-133a and mir-133d map to the same genomic locus in the Mmul_8.0.1 genome assembly, so the entries are merged.

Previous miRNA entry

Stem-loop sequence mml-mir-133d

AccessionMI0023646 (change log)
DescriptionMacaca mulatta miR-133d stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   --       aa  u  a        gccuc 
5'   agcuggu  aa gg accaaauc     u
     |||||||  || || ||||||||      
3'   ucgacca  uu cc ugguuuag     u
   ug       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-133d-5p

Accession MIMAT0028280
Sequence

1 - 

agcugguaaaauggaaccaaau

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-133d-3p

Accession MIMAT0028281
Sequence

39 - 

uugguccccuucaaccagcugu

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).