Stem-loop sequence mml-mir-4703

AccessionMI0023645 (change log)
DescriptionMacaca mulatta miR-4703 stem-loop
Gene family MIPF0001759; mir-4703
Stem-loop
   --                a         uu 
5'   uggcaauacaguacaa uacagugug  u
     |||||||||||||||| |||||||||  g
3'   accguuaugucauguu augucacgu  a
   uc                g         uu 
Get sequence
Deep sequencing
203 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 30912869-30912929 [+]
intergenic
Database links

Mature sequence mml-miR-4703-5p

Accession MIMAT0028278
Sequence

1 - 

uggcaauacaguacaaauacag

 - 22

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-4703-3p

Accession MIMAT0028279
Sequence

40 - 

guaguuguacuguauugccacu

 - 61

Get sequence
Deep sequencing192 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).