Stem-loop sequence mml-mir-7171

AccessionMI0023644 (change log)
DescriptionMacaca mulatta miR-7171 stem-loop
Stem-loop
   --c                          g   gc 
5'    gagauucuaggggcuaccacgcaccu ugu  a
      |||||||||||||||||||||||||| |||  c
3'    cucuaagauucccggugguguguggg aca  a
   cgu                          -   ag 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 12777879-12777948 [+]
intergenic
Database links

Mature sequence mml-miR-7171-5p

Accession MIMAT0028276
Sequence

1 - 

cgagauucuaggggcuaccacg

 - 22

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7171-3p

Accession MIMAT0028277
Sequence

49 - 

ugguggcccuuagaaucucugc

 - 70

Get sequence
Deep sequencing24 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).