Stem-loop sequence mml-mir-7170

AccessionMI0023643 (change log)
DescriptionMacaca mulatta miR-7170 stem-loop
Stem-loop
   --   a     g a  a  g     aaau   c 
5'   agg cugcu g gg cc cagag    gag c
     ||| ||||| | || || |||||    |||  
3'   ucc gacgg u cc gg gucuc    cuc u
   cc   a     g c  -  g     ----   a 
Get sequence
Deep sequencing
1654 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 91951819-91951879 [-]
intergenic
Database links

Mature sequence mml-miR-7170-5p

Accession MIMAT0028274
Sequence

1 - 

aggacugcuggaggaccgcaga

 - 22

Get sequence
Deep sequencing1605 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7170-3p

Accession MIMAT0028275
Sequence

41 - 

uggggcccugggcagaccucc

 - 61

Get sequence
Deep sequencing49 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).