Stem-loop sequence mml-mir-7169

AccessionMI0023642 (change log)
DescriptionMacaca mulatta miR-7169 stem-loop
Stem-loop
   --                     uu 
5'   ccuucagucuaggacucauuu  c
     |||||||||||||||||||||  c
3'   ggaagucagauccugaguaaa  c
   ag                     uu 
Get sequence
Deep sequencing
32 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 23628668-23628718 [-]
intergenic
Database links

Mature sequence mml-miR-7169-5p

Accession MIMAT0028272
Sequence

1 - 

ccuucagucuaggacucauuu

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7169-3p

Accession MIMAT0028273
Sequence

31 - 

augaguccuagacugaaggga

 - 51

Get sequence
Deep sequencing32 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).