Stem-loop sequence mml-mir-7168

AccessionMI0023641 (change log)
DescriptionMacaca mulatta miR-7168 stem-loop
Stem-loop
   --                  g     c  a 
5'   cauuuuacagauuaaaua ugagg au c
     |||||||||||||||||| ||||| ||  
3'   guaaaaugucuaauuugu acuuc ug u
   ag                  g     a  u 
Get sequence
Deep sequencing
313 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr17: 22449700-22449759 [-]
intergenic
Database links

Mature sequence mml-miR-7168-5p

Accession MIMAT0028270
Sequence

1 - 

cauuuuacagauuaaauaguga

 - 22

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7168-3p

Accession MIMAT0028271
Sequence

39 - 

aguguuuaaucuguaaaaugga

 - 60

Get sequence
Deep sequencing311 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).