Stem-loop sequence mml-mir-7166

AccessionMI0023639 (change log)
DescriptionMacaca mulatta miR-7166 stem-loop
Stem-loop
   u   --      u    -c   g  g   acu 
5'  ucu  caggug gacu  cca gu gcu   c
    |||  |||||| ||||  ||| || |||    
3'  aga  guccac cugg  ggu ca ugg   u
   g   au      u    aa   g  a   acg 
Get sequence
Deep sequencing
159 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 73225529-73225591 [-]
intergenic
Database links

Mature sequence mml-miR-7166-5p

Accession MIMAT0028266
Sequence

1 - 

uucucaggugugacucccaggu

 - 22

Get sequence
Deep sequencing89 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7166-3p

Accession MIMAT0028267
Sequence

41 - 

guggaaggucucaccuguaagag

 - 63

Get sequence
Deep sequencing69 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).