Stem-loop sequence mml-mir-1180

AccessionMI0023638 (change log)
DescriptionMacaca mulatta miR-1180 stem-loop
Gene family MIPF0000789; mir-1180
Stem-loop
   --gg      c  -          gu  u 
5'     acccac cg gccgggaaua  gc c
       |||||| || ||||||||||  || c
3'     ugggug gc cggccuuugu  ug u
   ugug      c  u          --  g 
Get sequence
Deep sequencing
536 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 19142309-19142364 [-]
intergenic
Database links

Mature sequence mml-miR-1180-5p

Accession MIMAT0028264
Sequence

1 - 

ggacccacccggccgggaaua

 - 21

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-1180-3p

Accession MIMAT0028265
Sequence

35 - 

uuuccggcucgcgugggugugu

 - 56

Get sequence
Deep sequencing534 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).