Stem-loop sequence mml-mir-7165

AccessionMI0023637 (change log)
DescriptionMacaca mulatta miR-7165 stem-loop
Stem-loop
   --   c     uu   a   a     gg   g 
5'   ggg gggaa  cag gcc gucag  cac g
     ||| |||||  ||| ||| |||||  |||  
3'   ucc cucuu  guc cgg caguc  gug g
   ga   u     -u   -   -     -a   a 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 75865682-75865741 [+]
intergenic
Database links

Mature sequence mml-miR-7165-5p

Accession MIMAT0028262
Sequence

1 - 

gggcgggaauucagagccaguca

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7165-3p

Accession MIMAT0028263
Sequence

41 - 

acggccuguuucucuccuag

 - 60

Get sequence
Deep sequencing22 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).