Stem-loop sequence mml-mir-3167

AccessionMI0023636 (change log)
DescriptionMacaca mulatta miR-3167 stem-loop
Gene family MIPF0001823; mir-3167
Stem-loop
   --                  auu       g 
5'   caguauuucugaaauucu   uucugaa u
     ||||||||||||||||||   |||||||  
3'   gucauaaagacuuuagga   aggacuu u
   ug                  ---       c 
Get sequence
Deep sequencing
97 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 119813225-119813283 [-]
intergenic
Database links

Mature sequence mml-miR-3167-5p

Accession MIMAT0028260
Sequence

1 - 

caguauuucugaaauucuauuuuc

 - 24

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-3167-3p

Accession MIMAT0028261
Sequence

39 - 

aaggauuucagaaauacuggu

 - 59

Get sequence
Deep sequencing97 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).