Stem-loop sequence mml-mir-3577

AccessionMI0023635 (change log)
DescriptionMacaca mulatta miR-3577 stem-loop
Stem-loop
   ug        cu   a c         uu 
5'   uggcagcc  gag g cagguggag  g
     ||||||||  ||| | |||||||||   
3'   accgucgg  cuc c gucuacuuu  u
   cg        uu   c u         cc 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 7527537-7527596 [+]
sense
ENSMMUT00000044595 ; RBM4B-202; intron 1
ENSMMUT00000014799 ; RBM4B-201; intron 2
Database links

Mature sequence mml-miR-3577-5p

Accession MIMAT0028258
Sequence

1 - 

uguggcagcccugagagccaggug

 - 24

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-3577-3p

Accession MIMAT0028259
Sequence

39 - 

ucugucccucuuggcugccagc

 - 60

Get sequence
Deep sequencing32 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).