Stem-loop sequence mml-mir-548h

AccessionMI0023634 (change log)
DescriptionMacaca mulatta miR-548h stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548h
(2 sentences)

Stem-loop
   --      a     u       c a   c 
5'   agaagu auugc guuuuug c uua u
     |||||| ||||| ||||||| | |||  
3'   ucuuca ugacg caaaaac g aau u
   ug      g     u       a a   u 
Get sequence
Deep sequencing
781 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr13: 27117405-27117462 [+]
intergenic
Database links

Mature sequence mml-miR-548h-5p

Accession MIMAT0028256
Sequence

1 - 

agaaguaauugcuguuuuugcc

 - 22

Get sequence
Deep sequencing22 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-548h-3p

Accession MIMAT0028257
Sequence

37 - 

caaaaacugcagugacuucugu

 - 58

Get sequence
Deep sequencing756 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).