Stem-loop sequence mml-mir-548g

AccessionMI0023633 (change log)
DescriptionMacaca mulatta miR-548g stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548g
(2 sentences)

Stem-loop
   --                c       a 
5'   agaguaauugugguuu ugucaug a
     |||||||||||||||| ||||||| a
3'   uuucauuaauaccaaa acgguau a
   gu                a       g 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr13: 18977407-18977461 [-]
intergenic
Database links

Mature sequence mml-miR-548g-5p

Accession MIMAT0028254
Sequence

1 - 

agaguaauugugguuucuguca

 - 22

Get sequence
Deep sequencing98 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-548g-3p

Accession MIMAT0028255
Sequence

34 - 

gcaaaaaccauaauuacuuuug

 - 55

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).