Stem-loop sequence mml-mir-7164

AccessionMI0023632 (change log)
DescriptionMacaca mulatta miR-7164 stem-loop
Stem-loop
   --u             g    a  a 
5'    aggaaaaggagug acag gg c
      ||||||||||||| |||| || a
3'    ucuuuuucuucgc uguc cc u
   ucu             -    c  u 
Get sequence
Deep sequencing
380 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 63172852-63172901 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-7164
mml-mir-7164chr12: 63172852-63172901 [+]
mml-mir-10bchr12: 63173247-63173356 [+]
Database links

Mature sequence mml-miR-7164-5p

Accession MIMAT0028252
Sequence

1 - 

uaggaaaaggaguggacagagg

 - 22

Get sequence
Deep sequencing378 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7164-3p

Accession MIMAT0028253
Sequence

30 - 

ccugucgcuucuuuuucuucu

 - 50

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).