Stem-loop sequence mml-mir-1245

AccessionMI0023631 (change log)
DescriptionMacaca mulatta miR-1245 stem-loop
Gene family MIPF0000620; mir-1245
Stem-loop
   --            a        aga  a 
5'   guaggccuuuag ucaucuaa   gu u
     |||||||||||| ||||||||   || u
3'   uauccggaaauc aguagauu   ca c
   ca            g        --a  a 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr12: 76385058-76385114 [-]
intergenic
Database links

Mature sequence mml-miR-1245-5p

Accession MIMAT0028250
Sequence

1 - 

guaggccuuuagaucaucua

 - 20

Get sequence
Deep sequencing74 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-1245-3p

Accession MIMAT0028251
Sequence

38 - 

gaugagcuaaaggccuauac

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).