Stem-loop sequence mml-mir-6505

AccessionMI0023630 (change log)
DescriptionMacaca mulatta miR-6505 stem-loop
Gene family MIPF0001805; mir-6505
Stem-loop
   --          -   uauc     a g  g  ccc 
5'   uuggaauagg gga    ucagc u uu ag   u
     |||||||||| |||    ||||| | || ||    
3'   aaccuugucc ucu    agucg a ag uc   g
   ga          a   --uc     - g  g  ucu 
Get sequence
Deep sequencing
1782 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 46365351-46365418 [+]
intergenic
Database links

Mature sequence mml-miR-6505-5p

Accession MIMAT0028248
Sequence

1 - 

uuggaauaggggauaucucagc

 - 22

Get sequence
Deep sequencing1752 reads, 6 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mml-miR-6505-3p

Accession MIMAT0028249
Sequence

48 - 

ugacuucuaccuguuccaaag

 - 68

Get sequence
Deep sequencing30 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).