Stem-loop sequence mml-mir-3059

AccessionMI0023629 (change log)
DescriptionMacaca mulatta miR-3059 stem-loop
Gene family MIPF0001766; mir-3059
Stem-loop
   --uuu   -    gc   a     u    cu 
5'      ccu cucu  ccc uaggg guag  c
        ||| ||||  ||| ||||| ||||   
3'      gga gaga  ggg aucuc cauc  u
   ggguu   a    -a   -     c    aa 
Get sequence
Deep sequencing
187 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 86053082-86053140 [-]
intergenic
Database links

Mature sequence mml-miR-3059-5p

Accession MIMAT0028246
Sequence

1 - 

uuuccucucugccccauagggu

 - 22

Get sequence
Deep sequencing123 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-3059-3p

Accession MIMAT0028247
Sequence

39 - 

ucuagggaagagaagguuggg

 - 59

Get sequence
Deep sequencing64 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).