Stem-loop sequence mml-mir-7163

AccessionMI0023628 (change log)
DescriptionMacaca mulatta miR-7163 stem-loop
Stem-loop
   --  ga          - --    a 
5'   gu  caagcuuggg c  ucug a
     ||  |||||||||| |  ||||  
3'   ca  guuugaaccc g  agac a
   uc  aa          c ac    u 
Get sequence
Deep sequencing
267 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 3605742-3605788 [-]
intergenic
Database links

Mature sequence mml-miR-7163-5p

Accession MIMAT0028244
Sequence

1 - 

gugacaagcuugggcucug

 - 19

Get sequence
Deep sequencing251 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-7163-3p

Accession MIMAT0028245
Sequence

26 - 

gacagccccaaguuugaaaccu

 - 47

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).