Stem-loop sequence mml-mir-1251

AccessionMI0023627 (change log)
DescriptionMacaca mulatta miR-1251 stem-loop
Gene family MIPF0000621; mir-1251
Stem-loop
   --  u  a    cca         --c  c 
5'   ac cu gcug   aaggcgcuu   uc u
     || || ||||   |||||||||   || u
3'   ug ga cgac   uuucgcgag   ag c
   ga  u  c    ucg         aca  u 
Get sequence
Deep sequencing
276 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr11: 97343443-97343501 [+]
intergenic
Database links

Mature sequence mml-miR-1251-5p

Accession MIMAT0028242
Sequence

1 - 

acucuagcugccaaaggcgcu

 - 21

Get sequence
Deep sequencing256 reads, 6 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-1251-3p

Accession MIMAT0028243
Sequence

39 - 

cgcuuugcucagccaguguag

 - 59

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).