Stem-loop sequence mml-mir-1306

AccessionMI0023626 (change log)
DescriptionMacaca mulatta miR-1306 stem-loop
Gene family MIPF0000531; mir-1306
Stem-loop
   c    u  ccu  a        gugg   a 
5'  cacc cc   gc aacgucca    ugc g
    |||| ||   || ||||||||    |||  
3'  gugg gg   cg uugcaggu    aug a
   -    u  ucu  g        ---a   g 
Get sequence
Deep sequencing
260 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 61825991-61826048 [+]
intergenic
Database links

Mature sequence mml-miR-1306-5p

Accession MIMAT0028240
Sequence

1 - 

ccaccuccccugcaaacgucc

 - 21

Get sequence
Deep sequencing254 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-1306-3p

Accession MIMAT0028241
Sequence

41 - 

acguuggcucugguggug

 - 58

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).