Stem-loop sequence mml-mir-4766

AccessionMI0023625 (change log)
DescriptionMacaca mulatta miR-4766 stem-loop
Gene family MIPF0001764; mir-4766
Stem-loop
   --  ug       a    g      uuu 
5'   uc  aaagagc guug uguuua   u
     ||  ||||||| |||| ||||||    
3'   ag  uuucucg uaac acaaau   u
   ga  gu       c    g      cau 
Get sequence
Deep sequencing
426 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 82839353-82839408 [-]
sense
ENSMMUT00000002612 ; PPPDE2-201; intron 5
Database links

Mature sequence mml-miR-4766-5p

Accession MIMAT0028238
Sequence

1 - 

ucugaaagagcaguugguguuu

 - 22

Get sequence
Deep sequencing270 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-4766-3p

Accession MIMAT0028239
Sequence

35 - 

acagcaaucgcucuuuuggaag

 - 56

Get sequence
Deep sequencing156 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).