Stem-loop sequence mml-mir-500b

AccessionMI0023624 (change log)
DescriptionMacaca mulatta miR-500b stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
   --u         uac       ag g   uau 
5'    aauccuugc   cugggug  a ugc   c
      |||||||||   |||||||  | |||   u
3'    uuaggaacg   gacccac  u acg   g
   guc         ---       -g g   uaa 
Get sequence
Deep sequencing
1507 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50017286-50017346 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-500b
mml-mir-532chrX: 50008220-50008297 [+]
mml-mir-188chrX: 50008578-50008663 [+]
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
mml-mir-660chrX: 50020567-50020663 [+]
mml-mir-502chrX: 50021926-50022005 [+]
Database links

Mature sequence mml-miR-500b-5p

Accession MIMAT0028236
Sequence

1 - 

uaauccuugcuaccugggugaga

 - 23

Get sequence
Deep sequencing767 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-500b-3p

Accession MIMAT0028237
Sequence

42 - 

gcacccaggcaaggauucu

 - 60

Get sequence
Deep sequencing721 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).