Stem-loop sequence hsa-mir-486-2

AccessionMI0023622 (change log)
Symbol HGNC:MIR486-2
DescriptionHomo sapiens miR-486-2 stem-loop
Gene family MIPF0000220; mir-486
Literature search

182 open access papers mention hsa-mir-486-2
(1081 sentences)

Stem-loop
   --                      -  ggg a 
5'   uccuguacugagcugccccgag cu   c g
     |||||||||||||||||||||| ||   | c
3'   aggacaugacucgacggggcuc gg   g a
   gu                      c  gaa u 
Get sequence
Deep sequencing
185812 reads, 646 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 41660444-41660507 [+]
antisense
OTTHUMT00000377171 ; ANK1-006; intron 1
ENST00000265709 ; ANK1-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-486-2
hsa-mir-486-1chr8: 41660441-41660508 [-]
hsa-mir-486-2chr8: 41660444-41660507 [+]
Database links

Mature sequence hsa-miR-486-5p

Accession MIMAT0002177
Previous IDshsa-miR-486
Sequence

1 - 

uccuguacugagcugccccgag

 - 22

Get sequence
Deep sequencing361964 reads, 153 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-486-3p

Accession MIMAT0004762
Sequence

43 - 

cggggcagcucaguacaggau

 - 63

Get sequence
Deep sequencing11736 reads, 104 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).