Stem-loop sequence hcmv-mir-US22

AccessionMI0023578 (change log)
DescriptionHuman cytomegalovirus miR-US22 stem-loop
Stem-loop
       a    u  -       u   c       --u    
5' gggg ccug uu cagcgug guc gcgggcg   gca 
   |||| |||| || ||||||| ||| |||||||   || u
3' cucc ggac aa gucgcgc cgg cgcucgu   cgg 
       -    c  u       -   c       uuu    
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EMBL:X17403.1) Overlapping transcripts
HEHCMVCG: 209922-209993 [+]
intergenic
Clustered miRNAs
< 10kb from hcmv-mir-US22
hcmv-mir-US22HEHCMVCG: 209922-209993 [+]
hcmv-mir-US25-1HEHCMVCG: 215245-215314 [-]
hcmv-mir-US25-2HEHCMVCG: 215447-215536 [-]
Database links

Mature sequence hcmv-miR-US22-5p

Accession MIMAT0028165
Sequence

8 - 

uguuucagcguguguccgcggg

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hcmv-miR-US22-3p

Accession MIMAT0028166
Sequence

46 - 

ucgccggccgcgcuguaaccagg

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1