Stem-loop sequence ssc-mir-7138

AccessionMI0023571 (change log)
DescriptionSus scrofa miR-7138 stem-loop
Literature search

1 open access papers mention ssc-mir-7138
(2 sentences)

Stem-loop
   --u   a     u u   -   a     gug 
5'    ccc gcaag g cca ucc ucucu   u
      ||| ||||| | ||| ||| |||||   c
3'    ggg cguuc c ggu agg agaga   c
   cgu   a     - -   c   -     aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 82423677-82423735 [-]
sense
OTTSUST00000007769 ; FGFR4-005; intron 1
OTTSUST00000004850 ; FGFR4-001; intron 2
OTTSUST00000007768 ; FGFR4-004; intron 2
OTTSUST00000007767 ; FGFR4-008; intron 2
OTTSUST00000007770 ; FGFR4-006; exon 2
ENSSSCT00000035375 ; FGFR4-005; intron 1
ENSSSCT00000036577 ; FGFR4-001; intron 2
ENSSSCT00000035801 ; FGFR4-004; intron 2
ENSSSCT00000032671 ; FGFR4-008; intron 2
ENSSSCT00000034246 ; FGFR4-006; exon 2
ENSSSCT00000015344 ; FGFR4-201; intron 2
Database links

Mature sequence ssc-miR-7138-5p

Accession MIMAT0028151
Sequence

1 - 

ucccagcaaguguccauccaucu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-7138-3p

Accession MIMAT0028152
Sequence

38 - 

gaggacuggccuugcagggugc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22953717 "Profiling microRNAs in lung tissue from pigs infected with Actinobacillus pleuropneumoniae" Podolska A, Anthon C, Bak M, Tommerup N, Skovgaard K, Heegaard PM, Gorodkin J, Cirera S, Fredholm M BMC Genomics. 13:459(2012).