Stem-loop sequence hsa-mir-6511a-3

AccessionMI0023565 (change log)
Symbol HGNC:MIR6511A3
DescriptionHomo sapiens miR-6511a-3 stem-loop
Gene family MIPF0001382; mir-6511
Stem-loop
   c             u   -gc   ca    agag 
5'  cugcaggcagaag ggg   uga  gggc    g
    ||||||||||||| |||   |||  ||||     
3'  gacguccgucuuc ccu   acu  cccg    g
   -             -   acc   cc    cguu 
Get sequence
Deep sequencing
2203 reads, 3.33 reads per million, 120 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 16368876-16368942 [+]
sense
OTTHUMT00000436256 ; NOMO3-011; exon 3
OTTHUMT00000436250 ; NOMO3-002; exon 20
OTTHUMT00000409528 ; NOMO3-001; 3'UTR (exon 21)
OTTHUMT00000436249 ; NOMO3-003; 3'UTR (exon 21)
ENST00000574894 ; NOMO3-011; exon 3
ENST00000575225 ; NOMO3-002; exon 20
ENST00000538468 ; NOMO3-201; 3'UTR (exon 20)
ENST00000399336 ; NOMO3-001; 3'UTR (exon 21)
ENST00000263012 ; NOMO3-003; 3'UTR (exon 21)
Database links

Mature sequence hsa-miR-6511a-5p

Accession MIMAT0025478
Sequence

5 - 

caggcagaaguggggcugacagg

 - 27

Get sequence
Deep sequencing1940 reads, 68 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-6511a-3p

Accession MIMAT0025479
Sequence

44 - 

ccucaccaucccuucugccugc

 - 65

Get sequence
Deep sequencing6848 reads, 118 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).
2
PMID:22313525 "Deep sequencing analysis of small non-coding RNAs reveals the diversity of microRNAs and piRNAs in the human epididymis" Li Y, Wang HY, Wan FC, Liu FJ, Liu J, Zhang N, Jin SH, Li JY Gene. 497:330-335(2012).