Stem-loop sequence hsa-mir-3690-2

AccessionMI0023561 (change log)
Symbol HGNC:MIR3690-2~withdrawn
DescriptionHomo sapiens miR-3690-2 stem-loop
Gene family MIPF0001618; mir-3690
Literature search

3 open access papers mention hsa-mir-3690-2
(10 sentences)

Stem-loop
          c   c   ac    c     caaa   gug 
5' cccaucu cac ugg  ccag guaga    gag   u
   ||||||| ||| |||  |||| |||||    |||   u
3' ggguaga gug acc  gguc caucu    cuc   u
          u   -   ca    -     auac   auc 
Get sequence
Deep sequencing
612 reads, 0 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrY: 1293918-1293992 [+]
intergenic
Database links

Mature sequence hsa-miR-3690

Accession MIMAT0018119
Sequence

10 - 

accuggacccagcguagacaaag

 - 32

Get sequence
Deep sequencing1212 reads, 43 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).