Stem-loop sequence gga-mir-196-4

AccessionMI0023559 (change log)
DescriptionGallus gallus miR-196-4 stem-loop
Gene family MIPF0000031; mir-196
Literature search

6 open access papers mention gga-mir-196-4
(9 sentences)

Stem-loop
   ---------     cucu      u          a      u    cucc 
5'          aacug    gugguu agguaguuuc uguugu gggg    a
            |||||    |||||| |||||||||| |||||| ||||    c
3'          uugac    cauuaa uccgucaaag acgaca cucu    c
   cuacuauag     --uu      u          c      u    cuuu 
Get sequence
Deep sequencing
203956 reads, 2.46e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-196-5p

Accession MIMAT0001121
Sequence

16 - 

uagguaguuucauguuguugg

 - 36

Get sequence
Deep sequencing1021521 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.