Stem-loop sequence cqu-mir-281-2

AccessionMI0023547 (change log)
DescriptionCulex quinquefasciatus miR-281-2 stem-loop
Gene family MIPF0000087; mir-46
Literature search

1 open access papers mention cqu-mir-281-2
(1 sentences)

Stem-loop
   uu   --c   u      -   aaa           -ua     c      ag ga 
5'   cug   agu ucgaau gug   auaaagagagc   uccgu gacagu  g  u
     |||   ||| |||||| |||   |||||||||||   ||||| ||||||  |  a
3'   gac   uua agcuua cau   uauuucucucg   aggua cuguca  u  u
   -u   aac   u      a   --g           uua     -      cu ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.640: 99719-99825 [+]
intergenic
Database links

Mature sequence cqu-miR-281-5p

Accession MIMAT0014358
Previous IDscqu-miR-281
Sequence

26 - 

aagagagcuauccgucgacagu

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-281-3p

Accession MIMAT0014359
Previous IDscqu-miR-281*
Sequence

63 - 

ugucauggaauugcucucuuu

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).