Stem-loop sequence cqu-mir-252-2

AccessionMI0023546 (change log)
DescriptionCulex quinquefasciatus miR-252-2 stem-loop
Gene family MIPF0000285; mir-252
Literature search

2 open access papers mention cqu-mir-252-2
(12 sentences)

Stem-loop
   ga       ac        a u  c     agaga 
5'   auucuuu  uaaguacu g gc gcagg     u
     |||||||  |||||||| | || |||||     u
3'   ugagaag  auucguga c cg cgucc     u
   --       cu        a c  u     ccaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.975: 115583-115653 [+]
intergenic
Database links

Mature sequence cqu-miR-252-5p

Accession MIMAT0014373
Previous IDscqu-miR-252
Sequence

11 - 

cuaaguacuagugccgcaggag

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-252-3p

Accession MIMAT0014374
Previous IDscqu-miR-252*
Sequence

44 - 

ccugcugcccaagugcuuaucg

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).