Stem-loop sequence mmu-mir-692-3

AccessionMI0023541 (change log)
Symbol MGI:Mir692-3
DescriptionMus musculus miR-692-3 stem-loop
Literature search

3 open access papers mention mmu-mir-692-3
(4 sentences)

Stem-loop
   gguggcagggccacaacca       cuggcgcgccccagggaucucugggcgaguaucu 
5'                    gcgcaga                                  c
                      |||||||                                  u
3'                    cgugucu                                  u
   --------------ccuuc       ccggaggaucagcacgaacucucacuccgcgagu 
Get sequence
Deep sequencing
273 reads, 12.5 reads per million, 48 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 74407065-74407173 [+]
sense
ENSMUST00000090860 ; Gm10116-201; exon 1
Database links

Mature sequence mmu-miR-692

Accession MIMAT0003471
Sequence

57 - 

aucucuuugagcgccucacuc

 - 77

Get sequence
Deep sequencing159 reads, 18 experiments
Evidence experimental; MPSS [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).