Stem-loop sequence bma-mir-2e

AccessionMI0023472 (change log)
DescriptionBrugia malayi miR-2e stem-loop
Literature search

3 open access papers mention bma-mir-2e
(29 sentences)

Stem-loop
   --cuuaaaauauug     -     ca  u    u a           uuacua 
5'               guuuu cggau  cc gaau g auugugauaug      u
                 ||||| |||||  || |||| | |||||||||||      u
3'               caaag gccua  gg cuua c ugacacuauac      u
   uguaauucauuuaa     u     cg  c    u a           uauucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold199: 29087-29194 [-]
intergenic
Database links

Mature sequence bma-miR-2e

Accession MIMAT0026369
Sequence

63 - 

uaucacaguacuauuccgggcau

 - 85

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).