Stem-loop sequence bma-mir-2g

AccessionMI0023459 (change log)
DescriptionBrugia malayi miR-2g stem-loop
Literature search

3 open access papers mention bma-mir-2g
(29 sentences)

Stem-loop
   aua        g a                    aa 
5'    caaguuua c uaucacaaacaaaauucugg  g
      |||||||| | ||||||||||||||||||||  u
3'    guuuaaau g auaguguuuguuuuaagacc  g
   aac        a a                    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold6: 1487667-1487741 [-]
intergenic
Database links

Mature sequence bma-miR-2g-5p

Accession MIMAT0037482
Sequence

14 - 

auaucacaaacaaaauucugg

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bma-miR-2g-3p

Accession MIMAT0026359
Sequence

44 - 

agaauuuuguuugugauaagau

 - 65

Get sequence
Evidence not experimental

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).