Stem-loop sequence osa-MIR818f

AccessionMI0023432 (change log)
DescriptionOryza sativa miR818f stem-loop
Gene family MIPF0000343; MIR806
Literature search

10 open access papers mention osa-MIR818f
(18 sentences)

Stem-loop
       ---  g     cu  c    uu  gguaaagaaa       u         c     -   -        a                -       u   --gaau     --uuuauuuuau     a    cuu    au 
5' gugg   gg caucc  ca uguu  cu          aauauaa ggauuuuga uuuuu cuu gcacuguu gaccacucgucuuauu aaaaaaa uug      uauua            uugug cuua   uauu  c
   ||||   || |||||  || ||||  ||          ||||||| ||||||||| ||||| ||| |||||||| |||||||||||||||| ||||||| |||      |||||            ||||| ||||   ||||   
3' uacc   cc guagg  gu acga  ga          uuauauu ccuaaaacu aaaaa gaa cgugacaa uuggugagcagaauaa uuuuuuu aac      auaau            aacac gaau   auga  c
       gua  g     au  -    gg  -gguagggca       c         a     c   a        a                a       u   agguuu     uuuuuacuuuuc     -    uuc    aa 
Get sequence
Deep sequencing
1357 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 18746588-18746866 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR818f
osa-MIR818fChr8: 18746588-18746866 [-]
osa-MIR1882dChr8: 18739319-18739478 [-]
Database links

Mature sequence osa-miR818f

Accession MIMAT0026335
Sequence

254 - 

gggagcauguaggauggccau

 - 274

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).